ID: 1203449938_1203449942

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1203449938 1203449942
Species Human (GRCh38) Human (GRCh38)
Location Un_GL000219v1:102771-102793 Un_GL000219v1:102807-102829
Sequence CCAGTCAGAATAGCTACTATTAA CAACAGATCTTGGGAGGCTGTGG
Strand - +
Off-target summary {0: 21, 1: 355, 2: 1912, 3: 4472, 4: 6052} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!