ID: 1203465260_1203465269

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1203465260 1203465269
Species Human (GRCh38) Human (GRCh38)
Location Un_GL000220v1:80088-80110 Un_GL000220v1:80110-80132
Sequence CCCCATCTTCTGGTAACATGCCC CAGGACCCATAACATGGGCAGGG
Strand - +
Off-target summary No data {0: 6, 1: 0, 2: 1, 3: 17, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!