ID: 1203468303_1203468316

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1203468303 1203468316
Species Human (GRCh38) Human (GRCh38)
Location Un_GL000220v1:105976-105998 Un_GL000220v1:106000-106022
Sequence CCTCTCCCCGCCCGCCGGCGGTG GTGTGGGAAGGCGTGGGGTGCGG
Strand - +
Off-target summary No data {0: 8, 1: 0, 2: 9, 3: 115, 4: 1195}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!