ID: 1203469874_1203469894

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1203469874 1203469894
Species Human (GRCh38) Human (GRCh38)
Location Un_GL000220v1:111665-111687 Un_GL000220v1:111709-111731
Sequence CCGCTCCCCGGCCGGGGCCGCGC CGTCGGGTGGGGGCTTTACCCGG
Strand - +
Off-target summary {0: 8, 1: 0, 2: 2, 3: 73, 4: 526} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!