ID: 1203471386_1203471410

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1203471386 1203471410
Species Human (GRCh38) Human (GRCh38)
Location Un_GL000220v1:116681-116703 Un_GL000220v1:116726-116748
Sequence CCCCCCCCCACCCCACGTCTCGT GGGGAGCGGTCGGGCGGCGGCGG
Strand - +
Off-target summary {0: 5, 1: 2, 2: 6, 3: 99, 4: 1199} {0: 7, 1: 0, 2: 6, 3: 83, 4: 752}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!