ID: 1203476229_1203476245

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1203476229 1203476245
Species Human (GRCh38) Human (GRCh38)
Location Un_GL000220v1:150289-150311 Un_GL000220v1:150329-150351
Sequence CCCCTCCTCCGGTCGCCGCCGCG CTGAGGGAGCTCGTCGGTGTGGG
Strand - +
Off-target summary {0: 9, 1: 3, 2: 6, 3: 22, 4: 217} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!