ID: 1203476981_1203476996

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1203476981 1203476996
Species Human (GRCh38) Human (GRCh38)
Location Un_GL000220v1:152661-152683 Un_GL000220v1:152699-152721
Sequence CCGTCCCCGCCTCGCCGCCGCCC GCGCGCGCGCGCGTGGCCGCCGG
Strand - +
Off-target summary No data {0: 7, 1: 1, 2: 6, 3: 45, 4: 331}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!