ID: 1203478600_1203478621

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1203478600 1203478621
Species Human (GRCh38) Human (GRCh38)
Location Un_GL000220v1:158435-158457 Un_GL000220v1:158462-158484
Sequence CCCGCGCCCCCGCCCCGGCGACG GGGTGCCGCGCGCGGGTCGGGGG
Strand - +
Off-target summary No data {0: 7, 1: 0, 2: 0, 3: 17, 4: 180}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!