ID: 1203479491_1203479507

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1203479491 1203479507
Species Human (GRCh38) Human (GRCh38)
Location Un_GL000224v1:68-90 Un_GL000224v1:113-135
Sequence CCTGGTGAGGAGCTGCCCCTTGG AGGGAGAAGCTGGGTGAGGCAGG
Strand - +
Off-target summary {0: 26, 1: 9, 2: 1, 3: 49, 4: 222} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!