ID: 1203480464_1203480473

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1203480464 1203480473
Species Human (GRCh38) Human (GRCh38)
Location Un_GL000224v1:6381-6403 Un_GL000224v1:6409-6431
Sequence CCTTGGGTCTGAGTTTCTGGGAG AGGGAGAAGCTGGGTGAGGCAGG
Strand - +
Off-target summary {0: 32, 1: 6, 2: 1, 3: 28, 4: 279} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!