ID: 1203498815_1203498817

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1203498815 1203498817
Species Human (GRCh38) Human (GRCh38)
Location Un_GL000224v1:179116-179138 Un_GL000224v1:179152-179174
Sequence CCTATGTGAGGGATAAACATTCA GTGTTGTGGAACCCTATCTGAGG
Strand - +
Off-target summary No data {0: 3, 1: 0, 2: 156, 3: 1808, 4: 3141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!