ID: 1203511341_1203511342

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1203511341 1203511342
Species Human (GRCh38) Human (GRCh38)
Location Un_KI270741v1:121356-121378 Un_KI270741v1:121378-121400
Sequence CCTATGTGAGGGATAAACATTCA AGACGAAAGCAGCAGTGTTGTGG
Strand - +
Off-target summary {0: 13, 1: 703, 2: 2178, 3: 2750, 4: 2294} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!