ID: 1203511341_1203511344 |
View in Genome Browser |
Spacer: 14 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1203511341 | 1203511344 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | Un_KI270741v1:121356-121378 | Un_KI270741v1:121393-121415 |
| Sequence | CCTATGTGAGGGATAAACATTCA | TGTTGTGGAACCCTATCTGAGGG |
| Strand | - | + |
| Off-target summary | {0: 13, 1: 703, 2: 2178, 3: 2750, 4: 2294} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||