ID: 1203552153_1203552157

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1203552153 1203552157
Species Human (GRCh38) Human (GRCh38)
Location Un_KI270743v1:172093-172115 Un_KI270743v1:172108-172130
Sequence CCGGGCCGGGGCAGGGTCTGGCA GTCTGGCAGGCTCTCAGGCCAGG
Strand - +
Off-target summary No data {0: 8, 1: 9, 2: 5, 3: 36, 4: 249}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!