ID: 1203589325_1203589332

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1203589325 1203589332
Species Human (GRCh38) Human (GRCh38)
Location Un_KI270747v1:40561-40583 Un_KI270747v1:40591-40613
Sequence CCGCTGCAGCTTTTTGCCCCCGA GCTTTTTGCCCTCACCGCTGCGG
Strand - +
Off-target summary {0: 2, 1: 6, 2: 24, 3: 185, 4: 727} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!