ID: 1203589329_1203589338 |
View in Genome Browser |
Spacer: 11 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1203589329 | 1203589338 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | Un_KI270747v1:40579-40601 | Un_KI270747v1:40613-40635 |
| Sequence | CCCGAAGCCACGGCTTTTTGCCC | GCTTTTTGCACCCACAGCCGGGG |
| Strand | - | + |
| Off-target summary | {0: 9, 1: 18, 2: 40, 3: 247, 4: 648} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||