ID: 1203589329_1203589338

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1203589329 1203589338
Species Human (GRCh38) Human (GRCh38)
Location Un_KI270747v1:40579-40601 Un_KI270747v1:40613-40635
Sequence CCCGAAGCCACGGCTTTTTGCCC GCTTTTTGCACCCACAGCCGGGG
Strand - +
Off-target summary {0: 9, 1: 18, 2: 40, 3: 247, 4: 648} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!