ID: 1203602302_1203602308

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1203602302 1203602308
Species Human (GRCh38) Human (GRCh38)
Location Un_KI270748v1:25149-25171 Un_KI270748v1:25184-25206
Sequence CCCTCTGCTTTCCTTTTCTGTAT TTAACTTAGTGGTTACCATGGGG
Strand - +
Off-target summary No data {0: 10, 1: 0, 2: 9, 3: 172, 4: 649}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!