ID: 1203603828_1203603833

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1203603828 1203603833
Species Human (GRCh38) Human (GRCh38)
Location Un_KI270748v1:40994-41016 Un_KI270748v1:41031-41053
Sequence CCAAGATGGCAGTGTGGAGCCAT GCGCACCCAGCAGTCGGCTGTGG
Strand - +
Off-target summary No data {0: 8, 1: 1, 2: 0, 3: 8, 4: 80}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!