ID: 1203657382_1203657386

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1203657382 1203657386
Species Human (GRCh38) Human (GRCh38)
Location Un_KI270753v1:11337-11359 Un_KI270753v1:11351-11373
Sequence CCTTCCTTCCTCTGCGTCTTGAT CGTCTTGATTTCCTCCAAGGTGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 3, 3: 44, 4: 552} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!