ID: 1203699247_1203699258

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1203699247 1203699258
Species Human (GRCh38) Human (GRCh38)
Location Un_GL000214v1:122450-122472 Un_GL000214v1:122500-122522
Sequence CCTGCACCTGTCGAGGATTTCCC CTAAGGCATAGGAAAGAGAGAGG
Strand - +
Off-target summary No data {0: 5, 1: 15, 2: 6, 3: 38, 4: 346}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!