ID: 1203731796_1203731798

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1203731796 1203731798
Species Human (GRCh38) Human (GRCh38)
Location Un_GL000216v2:98543-98565 Un_GL000216v2:98556-98578
Sequence CCGTCAGGGGGGCTCCAGGGACC TCCAGGGACCACCCCAGGCCCGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!