ID: 1203732761_1203732765

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1203732761 1203732765
Species Human (GRCh38) Human (GRCh38)
Location Un_GL000216v2:105821-105843 Un_GL000216v2:105835-105857
Sequence CCTCAGAACCTGGGCTTTACTTC CTTTACTTCTTGATGGGAGAAGG
Strand - +
Off-target summary {0: 5, 1: 0, 2: 0, 3: 27, 4: 450} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!