ID: 1203740053_1203740062

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1203740053 1203740062
Species Human (GRCh38) Human (GRCh38)
Location Un_GL000216v2:171057-171079 Un_GL000216v2:171107-171129
Sequence CCTGGGTCTCTCCCACAGGGGGC CCCCGTGCTCCAGCCCAGCCAGG
Strand - +
Off-target summary No data {0: 9, 1: 10, 2: 35, 3: 72, 4: 786}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!