ID: 1203759740_1203759743

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1203759740 1203759743
Species Human (GRCh38) Human (GRCh38)
Location EBV:6006-6028 EBV:6024-6046
Sequence CCGGACAATACACCCATCTGGAG TGGAGTTCAACCTAATTACATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 3, 4: 100}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!