ID: 900023663_900023665

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 900023663 900023665
Species Human (GRCh38) Human (GRCh38)
Location 1:202308-202330 1:202335-202357
Sequence CCACGATGCCTGTGAATATACAC ACCACATCATATACCAAGCCTGG
Strand - +
Off-target summary {0: 7, 1: 0, 2: 0, 3: 3, 4: 70} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!