ID: 900023704_900023720

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 900023704 900023720
Species Human (GRCh38) Human (GRCh38)
Location 1:202591-202613 1:202639-202661
Sequence CCCTGCCTGCCTTTGCTGGCCAG AAGGCTGCAGGGTTGGTCCCAGG
Strand - +
Off-target summary {0: 4, 1: 1, 2: 4, 3: 46, 4: 364} {0: 7, 1: 1, 2: 5, 3: 25, 4: 247}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!