ID: 900092007_900092014

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 900092007 900092014
Species Human (GRCh38) Human (GRCh38)
Location 1:924680-924702 1:924698-924720
Sequence CCACCTGCCCAGGGACCCGCTGG GCTGGCCCTCGAGCGCTTCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 34, 4: 371} {0: 1, 1: 0, 2: 1, 3: 5, 4: 85}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!