ID: 900092009_900092014

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 900092009 900092014
Species Human (GRCh38) Human (GRCh38)
Location 1:924683-924705 1:924698-924720
Sequence CCTGCCCAGGGACCCGCTGGCCC GCTGGCCCTCGAGCGCTTCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 45, 4: 433} {0: 1, 1: 0, 2: 1, 3: 5, 4: 85}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!