ID: 900094918_900094935

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 900094918 900094935
Species Human (GRCh38) Human (GRCh38)
Location 1:936395-936417 1:936435-936457
Sequence CCGCCTCCTAGGGCTCCTGGACG GTCCCGCCTTCTAGGGCTCCGGG
Strand - +
Off-target summary {0: 5, 1: 1, 2: 0, 3: 33, 4: 385} {0: 1, 1: 5, 2: 1, 3: 10, 4: 108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!