ID: 900094918_900094938

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 900094918 900094938
Species Human (GRCh38) Human (GRCh38)
Location 1:936395-936417 1:936439-936461
Sequence CCGCCTCCTAGGGCTCCTGGACG CGCCTTCTAGGGCTCCGGGAAGG
Strand - +
Off-target summary {0: 5, 1: 1, 2: 0, 3: 33, 4: 385} {0: 1, 1: 0, 2: 6, 3: 12, 4: 107}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!