ID: 900094920_900094942

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 900094920 900094942
Species Human (GRCh38) Human (GRCh38)
Location 1:936398-936420 1:936445-936467
Sequence CCTCCTAGGGCTCCTGGACGGAG CTAGGGCTCCGGGAAGGATGGGG
Strand - +
Off-target summary {0: 2, 1: 3, 2: 1, 3: 10, 4: 178} {0: 1, 1: 0, 2: 3, 3: 22, 4: 206}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!