ID: 900094923_900094938

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 900094923 900094938
Species Human (GRCh38) Human (GRCh38)
Location 1:936401-936423 1:936439-936461
Sequence CCTAGGGCTCCTGGACGGAGGGG CGCCTTCTAGGGCTCCGGGAAGG
Strand - +
Off-target summary {0: 2, 1: 3, 2: 1, 3: 39, 4: 259} {0: 1, 1: 0, 2: 6, 3: 12, 4: 107}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!