ID: 900094927_900094943

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 900094927 900094943
Species Human (GRCh38) Human (GRCh38)
Location 1:936410-936432 1:936452-936474
Sequence CCTGGACGGAGGGGGTCCCCGGT TCCGGGAAGGATGGGGTTCTCGG
Strand - +
Off-target summary {0: 2, 1: 3, 2: 0, 3: 18, 4: 210} {0: 1, 1: 0, 2: 1, 3: 13, 4: 155}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!