ID: 900097938_900097950

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 900097938 900097950
Species Human (GRCh38) Human (GRCh38)
Location 1:947931-947953 1:947963-947985
Sequence CCTGCCCCCAAACCTCCTGAATG CCCTCATCAGCCCCTCCAAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 38, 4: 375} {0: 1, 1: 0, 2: 0, 3: 33, 4: 321}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!