ID: 900101546_900101567

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 900101546 900101567
Species Human (GRCh38) Human (GRCh38)
Location 1:964228-964250 1:964272-964294
Sequence CCCTCCTCCCTCTGTTTACCCAC CCACCCTGGAGTCGGGGCTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 77, 4: 701} {0: 1, 1: 1, 2: 2, 3: 35, 4: 312}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!