ID: 900105177_900105188

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 900105177 900105188
Species Human (GRCh38) Human (GRCh38)
Location 1:978083-978105 1:978112-978134
Sequence CCGCTTCCCCCGCAACCCCGGGA TGCCCCGCACACGGCCGCCCCGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 2, 3: 18, 4: 316} {0: 1, 1: 1, 2: 1, 3: 12, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!