ID: 900105213_900105223

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 900105213 900105223
Species Human (GRCh38) Human (GRCh38)
Location 1:978176-978198 1:978214-978236
Sequence CCACCCTAACCCTGCACACTCTT TGCCCCGCACACGCCCGCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 290} {0: 1, 1: 2, 2: 1, 3: 15, 4: 221}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!