ID: 900115391_900115406

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 900115391 900115406
Species Human (GRCh38) Human (GRCh38)
Location 1:1025828-1025850 1:1025878-1025900
Sequence CCTGGAGCTGGGAGGGGGGTCTG CCCAACCCCGGGGCTCCTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 90, 4: 680} {0: 1, 1: 0, 2: 3, 3: 40, 4: 323}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!