ID: 900118136_900118140

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 900118136 900118140
Species Human (GRCh38) Human (GRCh38)
Location 1:1037206-1037228 1:1037224-1037246
Sequence CCAGAGGCCTGGAGCCAACTGGA CTGGATTTAAAGAGGTGCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 27, 4: 240} {0: 1, 1: 0, 2: 1, 3: 11, 4: 155}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!