ID: 900119936_900119944

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 900119936 900119944
Species Human (GRCh38) Human (GRCh38)
Location 1:1044271-1044293 1:1044285-1044307
Sequence CCCTGGCTCTCGGCGGGCGGCGG GGGCGGCGGGGACGGGGCTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 130} {0: 1, 1: 0, 2: 34, 3: 259, 4: 1834}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!