ID: 900129686_900129696

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 900129686 900129696
Species Human (GRCh38) Human (GRCh38)
Location 1:1082087-1082109 1:1082123-1082145
Sequence CCCCAGGACTCAGCGCCAGGGCA CAGTGAGGCAGTGACTTGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 267} {0: 1, 1: 0, 2: 1, 3: 27, 4: 305}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!