ID: 900130592_900130603

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 900130592 900130603
Species Human (GRCh38) Human (GRCh38)
Location 1:1085558-1085580 1:1085581-1085603
Sequence CCAGCCCCGCTCCACTCGCCCCT CGTGATGCCCTGAGGGCCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 46, 4: 718} {0: 1, 1: 0, 2: 1, 3: 6, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!