ID: 900146483_900146497

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 900146483 900146497
Species Human (GRCh38) Human (GRCh38)
Location 1:1161020-1161042 1:1161055-1161077
Sequence CCAATCCCGAGACCACCGAAGCC CCTTTGCCCCTCCTGCCCCCCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 74, 4: 662}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!