ID: 900155877_900155894

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 900155877 900155894
Species Human (GRCh38) Human (GRCh38)
Location 1:1203109-1203131 1:1203159-1203181
Sequence CCTGGAGCCTGGAGTGGGAGGCT AGAGAGGGCTGGCCTGGAGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 173, 4: 1362} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!