ID: 900162821_900162837

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 900162821 900162837
Species Human (GRCh38) Human (GRCh38)
Location 1:1232392-1232414 1:1232443-1232465
Sequence CCCCAGGGCGATGTCGGGCCGCA CGCCGCCTTCCTGGCAGTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 40} {0: 1, 1: 0, 2: 0, 3: 12, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!