ID: 900162830_900162837

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 900162830 900162837
Species Human (GRCh38) Human (GRCh38)
Location 1:1232425-1232447 1:1232443-1232465
Sequence CCCCGCGCCCGCGCGCGCCGCCG CGCCGCCTTCCTGGCAGTGCTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 31, 3: 179, 4: 870} {0: 1, 1: 0, 2: 0, 3: 12, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!