ID: 900168747_900168758

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 900168747 900168758
Species Human (GRCh38) Human (GRCh38)
Location 1:1255875-1255897 1:1255899-1255921
Sequence CCCCCCAGAGCCCAGGCTTTCTG CTCCCCTGCCTCGGGGCTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 56, 4: 495} {0: 1, 1: 0, 2: 2, 3: 48, 4: 446}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!