ID: 900171107_900171118

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 900171107 900171118
Species Human (GRCh38) Human (GRCh38)
Location 1:1269286-1269308 1:1269303-1269325
Sequence CCCCAAAGCCCCTCAGCCACACC CACACCCGAGACTGGGGAGAGGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 2, 3: 41, 4: 356} {0: 3, 1: 1, 2: 1, 3: 25, 4: 203}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!