ID: 900174356_900174363

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 900174356 900174363
Species Human (GRCh38) Human (GRCh38)
Location 1:1285264-1285286 1:1285278-1285300
Sequence CCAGGACTCCAGAGCCTCCAGCG CCTCCAGCGCGGGACTGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 297} {0: 1, 1: 1, 2: 0, 3: 13, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!