ID: 900174356_900174367

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 900174356 900174367
Species Human (GRCh38) Human (GRCh38)
Location 1:1285264-1285286 1:1285289-1285311
Sequence CCAGGACTCCAGAGCCTCCAGCG GGACTGGGCAGGCAGTGGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 297} {0: 1, 1: 0, 2: 6, 3: 65, 4: 545}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!